MedicineLakex

 

Colegioveterinario.cl

Rev. Inst. Med. Trop. Sao Paulo53(1):39-44, January-February, 2011doi: 10.1590/S0036-46652011000100007 ANTEMORTEM DIAGNOSIS OF HUMAN RABIES IN A VETERINARIAN INFECTED WHEN HANDLING A
HERBIVORE IN MINAS GERAIS, BRAZIL
Mariana Gontijo de BRITO(1), Talita Leal CHAMONE(1), Fernando José da SILVA(2), Marcelo Yohito WADA(3), Alexandre Braga de MIRANDA(4),
Juliana Galera CASTILHO(5), Maria Luiza CARRIERI(5), Ivanete KOTAIT(5) & Francisco Leopoldo LEMOS (1)
The Ministry of Health's National Human Rabies Control Program advocates pre-exposure prophylaxis (PEP) for professionals involved with animals that are at risk of contracting rabies. We report an antemortem and postmortem diagnosis of rabies in a veterinarian who became infected when handling herbivores with rabies. The antemortem diagnosis was carried out with a saliva sample and a biopsy of hair follicles using molecular biology techniques, while the postmortem diagnosis used a brain sample and conventional techniques. The veterinarian had collected samples to diagnose rabies in suspect herbivores (bovines and caprines) that were subsequently confirmed to be positive in laboratory tests. After onset of classic rabies symptoms, saliva and hair follicles were collected and used for antemortem diagnostic tests and found to be positive by RT-PCR. Genetic sequencing showed that the infection was caused by variant 3 (Desmodus rotundus), a finding confirmed by tests on the brain sample. It is essential that professionals who are at risk of infection by the rabies virus undergo pre-exposure prophylaxis. This study also confirms that molecular biology techniques were used successfully for antemortem diagnosis and therefore not only allow therapeutic methods to be developed, but also enable the source of infection in human rabies cases to be identified accurately and quickly.
KEYWORDS: Human rabies; Non-bite rabies exposure; Antemortem and postmortem diagnosis; Molecular biology.
dogs also fell, and the last case was reported in 2003. In 2004 and 2005, one case of human rabies was reported each year; epidemiological and Rabies is an acute, progressive, fatal disease caused by a neurotropic laboratory investigation of both cases confirmed the disease had been RNA virus from the family Rhabdoviridae, genus Lyssavirus. Mammals transmitted by hematophagous bats.
from the orders Carnivora and Chiroptera are the main reservoirs13. According to WHO estimates, around 55,000 people throughout the The progressive increase in the incidence of bovine rabies in Minas world die from the disease every year, 99% of whom are on the Asian Gerais is evidence of the change in the epidemiological profile of rabies, and African continents16.
which is reflected in the increasing importance of transmission by hematophagous bats and other wild animals1,2,14. In Brazil, epidemiological investigations and laboratory diagnosis are essential to guide measures implemented as part of the National Human We describe a case of human rabies in 2006 in the municipality Rabies Control Program.
of São João del Rei, Minas Gerais, involving a health professional (a veterinarian) who had not previously been immunized against rabies and In Minas Gerais as well as Brazil as a whole, the incidence of human who refused a post-exposure regimen after he came into contact with a rabies transmitted by cats and dogs has been falling over the years. herbivore that subsequently died and was confirmed in laboratory tests However, there has been a change in the epidemiological profile of the to have been infected with the rabies virus.
disease, and cases of human rabies transmitted by bats have been reported. MATERIALS AND METHODS
Although there was an increase in the number of samples sent for laboratory diagnosis of canine and feline rabies in Minas Gerais from Epidemiological investigation and clinical data: The data were
2000 to 2006, the number of confirmed cases of rabies in these species fell obtained from the National Information System for Notifiable Diseases during the same period. The number of human rabies cases transmitted by (SINAN) and the patient's medical records. The epidemiological (1) SES Health Surveillance Department/MG, Belo Horizonte, Av. Afonso Pena 2300, B. Funcionários, 30130-007 Belo Horizonte, MG, Brazil.
(2) São João Del Rei Regional Department of Health. Av. Amilcar Savassi S/N, Sericícola, 36200-494 São João Del Rei, MG, Brazil.
(3) Department of Health Surveillance/MS, Brasília/DF, SCS, quadra 04, bloco A, lote 67/97, 70304-000 Brasília/DF, Brazil.
(4) Eduardo de Menezes Hospital, Rua Dr. Cristiano Resende 2213B, Bom Sucesso, 30620-740 Belo Horizonte, MG, Brazil.
(5) The Pasteur Institute of São Paulo, Av. Paulista 393, Cerqueira Cesar, 01311-000 São Paulo, SP, Brazil.
Correspondence to: Ivanete Kotait, Instituto Pasteur, Av. Paulista 393, 01311-000 São Paulo, SP, Brasil. E-mail: [email protected]

BRITO, M.G.; CHAMONE, T.L.; SILVA, F.J.; WADA, M.Y.; MIRANDA, A.B.; CASTILHO, J.G.; CARRIERI, M.L.; KOTAIT, I. & LEMOS, F.L. - Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil. Rev. Inst. Med. Trop. São Paulo, 53(1): 39-44, 2011.
investigation, which was carried out by a staff from the local Department postmortem diagnosis, respectively) were visualized under UV light of Agriculture, involved the patient's family and neighborhood.
after gel electrophoresis on 1% agarose gel containing ethidium bromide in TBE buffer.
On May 15, the Minas Gerais Department of Health was notified of a suspected rabies case in a patient admitted to Eduardo de Menezes DNA sequencing: The amplified DNA fragments were purified with
Hospital, a reference hospital in the state for infectious and contagious the GFXTM PCR DNA and Gel Band Purification kit (GE Healthcare), diseases. The patient was a 27-year-old male from Campo das Vertentes, visually quantified with a Low DNA Mass Ladder (Invitrogen) and state of Minas Gerais, Brazil.
sequenced using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with the sense and antisense primers according to Onset of the disease occurred on May 7, 2006, with occipital the manufacturer's instructions. The reaction products were then resolved headache and pain that radiated to the right side and was predominant in in an ABI-3130 automatic sequencer (Applied BiosystemsTM).
the upper limb, the area where the patient had probably come into contact with material from the infected herbivore. The signs evolved to include Phylogenetic analysis: For the antemortem diagnosis, a 249 bp
mental confusion and a reduced level of consciousness. region of the nucleoprotein (N) gene located between nucleotides 1286 and 1533 of the Pasteur Virus (PV) (GenBank accession number The patient was put in deep sedation induced with ketamine and M13215.1) was analyzed, while for the postmortem diagnosis a 1478 midazolam, and antiviral drugs were administered (ribavirin and bp region of the N gene located between nucleotides 55 and 1533 of the amantadine). After developing intense polyuria, hyponatremia and PV virus was analyzed. First, the raw sequencing data were edited using episodes of cardiac arrhythmia that were controlled with medication, CHROMAS version 2.24 software (Copyright 1998-2004 Technelysium he died on May 26, 2006, as a result of reentrant arrhythmias that were Pty Ltd.), and the final consensus sequence for each sample (neck-skin, difficult to control, followed by cardiac arrest (Fig. 1). saliva and brain tissue) was aligned with homologous sequences in GenBank using the CLUSTAL/W method with the Bioedit program and Laboratory diagnosis by RT-PCR and DNA sequencing
submitted to BLASTn to confirm sequence identity7. The alignment was then used to build a neighbor-joining distance-based phylogenetic tree RT-PCR: An approximately 1 cm2 sample of neck-skin biopsy and
using the Kimura two-parameter correction model with 1,000 bootstrap a saliva sample were collected from the patient before his death, and a replicates and the Mega 2.1 program8. The identities between the aligned brain sample was collected postmortem from the same patient.
sequences were calculated using the Bioedit program.
Total RNA was extracted from the neck-skin sample (cut into small Direct immunofluorescence: This was carried out using a
pieces with a scalpel), from the brain sample and from 300 µL of saliva, fluorescein-conjugated anti-rabies polyclonal antibody produced in using TRIzol® reagent (Invitrogen) according to the manufacturer's hyperimmunized rabbits by the Pasteur Institute of São Paulo and slides instructions. Aliquots of a "Challenge Virus Standard" (CVS) strain prepared with impressions of brain tissue, as described by DEAN et al. of fixed virus and water were used as positive and negative controls, respectively. RT-PCR was carried out with sense primer 504 (5'- TATACTCGAATCATGATGAATGGAGGTCGACT -3') and antisense primer 304 Viral isolation in mice: A suspension was prepared from the brain
(5'-TTGACGAAGATCTTGCTCAT-3') for antemortem diagnosis and sample and inoculated intracerebrally in eight 21-day-old Swiss albino sense primer 21G (5'-ATGTAACACCTCTACAATG-3') and antisense mice, according to the technique advocated by KOPROWSKI (1996)9 primer 304 (TTGACGAAGATCTTGCTCAT) for postmortem diagnosis as previously described by MACEDO et al. (2006)10.
Antigenic typing by indirect immunofluorescence using
monoclonal antibodies: Slides prepared with brain tissue from first-
The RT-PCR products (249 bp and 1478 bp for antemortem and passage mice were typed antigenically using a panel of monoclonal Fig. 1 - Timeline of the course of rabies in the patient, Minas Gerais, Brazil, 2009.
BRITO, M.G.; CHAMONE, T.L.; SILVA, F.J.; WADA, M.Y.; MIRANDA, A.B.; CASTILHO, J.G.; CARRIERI, M.L.; KOTAIT, I. & LEMOS, F.L. - Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil. Rev. Inst. Med. Trop. São Paulo, 53(1): 39-44, 2011.
antibodies provided by the Centers for Disease Control and Prevention in herbivores in various municipalities in the region, although these had (CDC), in Atlanta, USA, to characterize the variants isolated on the been neither reported nor confirmed by laboratory tests.
American continent6. Serological testing could not be carried out because serum samples were not collected at any stage of the disease.
The patient did not report having been attacked by bats, dogs or other animals and had never had either pre-exposure antirabies vaccinations or antirabies prophylaxis after contact with suspect herbivores. He did not use any type of personal protection equipment to collect samples from Epidemiological investigation and clinical data: Exposure probably
animals suspected of rabies.
occurred in March 2006 in the town of Prados, state of Minas Gerais, Brazil, and it was suggested that the virus might have been transmitted by an animal from the caprine species that the patient, a veterinarian, was attending to. The municipality where he had been working had had RT-PCR, DNA sequencing and phylogenetic analysis: The neck-
several cases of rabies in herbivores, all confirmed by laboratory tests skin biopsy and saliva samples were positive by RT-PCR, yielding a 249 at the Minas Gerais Institute of Agriculture (IMA). It was not possible, bp fragment, and the brain sample, which was also positive by RT-PCR, however, to identify the species of herbivore involved in the infection yielded a 1478 bp fragment. No amplified products were detected in the or the exact date and time that the infection occurred. The veterinarian negative control, and no extra band was detected. A total of 249 and 1478 worked on various farms in the municipalities of Prados, Coronel Xavier nucleotides located between nucleotides 1286/1533 and 55/1533 of the Chaves, Tiradentes and São João del Rei. In the same month there were rabies virus genome, respectively, were analyzed using the PV strain as four cases of rabies in herbivores (three in bovines and one in a caprine) a reference. Final sequences of 106 and 1290 nucleotides of the N-gene in the municipality of Prados. There were also two confirmed cases in region between nucleotides 1314-1420 and 130-1420 of the PV virus bovines in other municipalities in the São João del Rei Regional Health were obtained for antemortem and postmortem diagnosis, respectively. Department district; one of these was in Madre de Deus de Minas, and the other in Entre Rios de Minas. According to information provided by The topology of the phylogenetic tree (106 bp - antemortem the IMA (personal information), there had been clinical cases of rabies diagnosis) showed four distinct clusters (Fig. 2): 1 - samples associated Fig. 2 - Phylogenetic tree based on the sequence of 106 nucleotides of the rabies virus N gene between positions 1314-1420. Phylogenetic analysis was performed using the neighbor-joining
method. Isolates IP3895/neck-skin biopsy and saliva and IP4435/Central Nervous System, which are shown underlined and bold, segregated into the same group related to viruses isolated in
hematophagous bats (Desmodus rotundus). The names of the samples in the tree refer to the GenBank accession numbers.
BRITO, M.G.; CHAMONE, T.L.; SILVA, F.J.; WADA, M.Y.; MIRANDA, A.B.; CASTILHO, J.G.; CARRIERI, M.L.; KOTAIT, I. & LEMOS, F.L. - Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil. Rev. Inst. Med. Trop. São Paulo, 53(1): 39-44, 2011.
Fig. 3 - Phylogenetic tree based on the sequence of 1290 nucleotides of the rabies virus N gene between positions 130-1420. Phylogenetic analysis was performed using the neighbor-joining
method. Isolates IP4435/Central Nervous System, which are shown underlined and bold, segregated into the same group related to viruses isolated in hematophagous bats (Desmodus rotundus).
The names of the samples in the tree refer to the GenBank accession numbers.
with hematophagous bats; 2 - samples associated with insectivorous bats; DISCUSSION
3 - fixed samples; and 4 - samples associated with dogs.
With the increasing number of rabies cases in economically important Isolates IP3895 (neck-skin biopsy and saliva) and IP4435 (brain tissue) animals, veterinarians or animal owners who handle these animals are had 100% identity between them and segregated into a cluster formed by at risk of contracting the disease since, irrespective of the species they Desmodus rotundus isolates (bootstrap = 97) from different regions of Brazil. belong to, infected animals eliminate the virus in their saliva during the pre-symptomatic and symptomatic phases3,5.
The topology of the phylogenetic tree (1290 bp - postmortem diagnosis) showed four distinct clusters (Fig. 3): 1 - associated with The Brazilian Ministry of Health Regulations for the Prophylaxis of hematophagous bats; 2 - samples associated with insectivorous bats; Human Rabies recommend that individuals whose work exposes them 3 - fixed samples; and 4 - samples associated with dogs.
to a risk of contracting rabies through contact with animals receive pre-exposure prophylaxis (PEP) and that those who have been exposed Isolate IP4435 (brain tissue) segregated into a cluster formed by to animals with rabies receive post-exposure vaccination. In the case Desmodus rotundus isolates (bootstrap = 100) from different regions described here, the patient had not received PEP and had refused post- exposure prophylaxis; this lack of immunological response led to his death11. Direct immunofluorescence: The slides were positive for the rabies
antigen and the test was specific as no fluorescence was detected in the Exposure probably occurred in March 2006 in the town of negative control.
Prados, Minas Gerais, and the likely transmitter was a caprine that the veterinarian had been attending to. He had been working in the Viral isolation in mice: The virus was isolated 10 days after
municipality of Prados, where there had been cases of animal rabies that inoculation of the mice.
had been confirmed in laboratory tests. However, the type of herbivore and exact place and time the infection occurred could not be determined Antigenic typing by indirect immunofluorescence using
with any degree of certainty as the patient had been working on various monoclonal antibodies: The reactivity pattern of the virus isolated from
farms in the region. mice was compatible with that of variant 3 (AgV3), which is characteristic of the variant isolated from the hematophagous bat Desmodus rotundus, As there was no record of the veterinarian having been bitten by the main transmitter of rabies to herbivores.
bovines or caprines, exposure must have occurred when he was handling BRITO, M.G.; CHAMONE, T.L.; SILVA, F.J.; WADA, M.Y.; MIRANDA, A.B.; CASTILHO, J.G.; CARRIERI, M.L.; KOTAIT, I. & LEMOS, F.L. - Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil. Rev. Inst. Med. Trop. São Paulo, 53(1): 39-44, 2011.
infected animals and came into contact with their saliva. The records molecular e o post-mortem a partir do tecido cerebral e de técnicas show that liquids were administered orally to an infected animal in convencionais. O médico veterinário coletou amostras para diagnóstico de March. Contamination may also have occurred when a brain sample was raiva em herbívoros (bovinos e caprinos) suspeitos que, posteriormente, being collected to be sent to the diagnostic laboratory for confirmation foram confirmados positivos em laboratório. Após a apresentação dos of suspected rabies. On both occasions the veterinarian failed to use sintomas clássicos de raiva e realizadas as provas de diagnóstico ante- personal protection equipment (PPE).
mortem com saliva e folículo piloso, ambas as amostras apresentaram resultados positivos pelo nested-RT-PCR. O sequenciamento genético The present study describes the first human rabies case successfully revelou que a infecção se deu pela variante 3 do Desmodus rotundus, diagnosed antemortem using molecular biology methods standardized resultados estes confirmados com a amostra do cérebro. É indispensável by MACEDO et al. (2006)10. The recent cases of rabies in Wisconsin, que profissionais expostos ao risco de infecção pelo vírus da raiva USA, and Recife, Brazil, in which patients survived when coma was realizem a profilaxia pré-exposição. Ressalta-se, também, que as técnicas induced and antiviral drugs were used, show that molecular methods are de biologia molecular apresentaram bons resultados para a realização de important tools for the early identification of human rabies and allow the diagnóstico ante-mortem, propiciando o desenvolvimento de métodos Milwaukee15 or Recife12 protocols to be used.
terapêuticos, e determinando com precisão e rapidez a fonte de infecção dos casos de raiva humana.
Antigenic and genetic studies identified variant 3 - compatible with the variant found in the hematophagous bat Desmodus rotundus, the main transmitter of rabies in herbivores - in the saliva, hair follicles and brain tissue of the patient, confirming the data from the epidemiological 1. Barbosa AD, Silva JA, Moreira EC, Meneses JNC, Magalhães DF, Menezes FL et al. Distribuição espacial e temporal da raiva canina e felina em Minas Gerais, 2000 a 2006. Arq Bras Med Vet Zoot. 2008;60:837-42.
Efforts should be made by federal, state and municipal health and 2. Brito MG, Chamone TL. Ações de controle da raiva canina e felina no estado de Minas agricultural institutions as well as by universities to make people aware Gerais, 1999-2002. Bol Epidemiol. 2002;6:1-8.
that the antirabies vaccine is strongly recommended for veterinarians and can help avoid cases like that described here.
3. Carrieri ML, Peixoto ZM, Paciência ML, Kotait I, Germano, PM. Laboratory diagnosis of equine rabies and its implications for human postexposure prophylaxis. J Virol Methods. 2006;138:1-9.
We conclude that:1. In our study the molecular biology methods currently available 4. Dean DJ, Albelseth MK, Atanasiu P. The fluorescent antibody test. In: Meslin, FX, Kaplan for antemortem laboratory diagnosis of rabies were used successfully. MM, Koprowsky H, editors. Laboratory techniques in rabies. 4th ed. Genebra: World These allow therapeutic methods for the treatment of human rabies Health Organization; 1996. p. 88-95.
to be developed and maintained and the source of infection in rabies 5. Delpietro HA, Larghi OP, Russo RG. Virus isolation from saliva and salivary glands of cases to be accurately identified before death, so that a more thorough cattle naturally infected with paralytic rabies. Prev Vet Med. 2001;48:223-8.
epidemiological investigation can be undertaken. 6. Diaz AM, Papo S, Rodriguez A, Smith, JS. Antigenic analysis of rabies-virus isolates 2. It is essential that professionals who are at risk of infection by the from Latin American and the Caribbean. Zentralbl Veterinarmed B. 1994;41:153-60.
rabies virus undergo PEP to ensure they are appropriately immunized for 7. Hall TA. Bioedit: a user-friendly biological sequence alignment editor and analysis field activities such as the collection of samples to diagnose animal rabies.
program for Windows 95/98/nt. Nucl Acids Symp Ser. 1999;41:95-8.
3. Individuals exposed to suspect animals, particularly those that 8. Kumar S, Tamura K, Jakbosen IE, Nei M. Mega 2: molecular evolutionary genetic analysis have been confirmed rabies-positive in laboratory diagnostic tests, software. Tempe: Arizona State University; 2001.
must undergo post-exposure prophylaxis as advocated by the Brazilian 9. Koprowski H. The mouse inoculation test. In: Meslin FX, Kaplan MM, Koprowsky H, Ministry of Health and World Health Organization.
editors. Laboratory techniques in rabies. 4th ed. Genebra: World Health Organization; 1996. p. 80-7.
4. Educational programs focusing on PEP and appropriate serological follow-up should be developed with universities and veterinary services.
10. Macedo CI, Carnieli Jr P, Brandão PE, Travassos da Rosa ES, Oliveira RN, Castilho JG, et al. Diagnosis of human rabies cases by Polymerase Chain Reaction of neck-skin samples. Braz J Infect Dis. 2006;10:341-5.
11. Ministério da Saúde. Fundação Nacional de Saúde. Guia de vigilância epidemiológica. Diagnóstico ante-mortem de raiva humana em médico veterinário
5a ed. Brasília: Ministério da Saúde; 2002. 2 v.
infectado por manipulação de herbívoro, Minas Gerais, Brasil
12. Ministério da Saúde. Protocolo para tratamento de raiva humana no Brasil. Epidemiol Serv Saúde. 2009;18:385-94.
O Programa Nacional de Controle da Raiva Humana do Ministério da Saúde preconiza o esquema profilático pré-exposição (PEP) para 13. Rupprecht CE, Hanlon CA, Hemachudha T. Rabies re-examined. Lancet Infect Dis. profissionais envolvidos com animais expostos ao risco de contraírem raiva. O presente trabalho relata o diagnóstico de raiva (ante e post- mortem) em veterinário infectado por manipulação de herbívoros 14. Schneider MC, Belloto A, Adé MP, Hendrickx S, Leanes LF, Rodrigues MJF, et al. Current status of human rabies transmitted by dogs in Latin America. Cad Saúde Pública. raivosos. O diagnóstico laboratorial ante-mortem foi efetuado a partir da saliva e biópsia de folículo piloso, utilizando técnicas de biologia BRITO, M.G.; CHAMONE, T.L.; SILVA, F.J.; WADA, M.Y.; MIRANDA, A.B.; CASTILHO, J.G.; CARRIERI, M.L.; KOTAIT, I. & LEMOS, F.L. - Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil. Rev. Inst. Med. Trop. São Paulo, 53(1): 39-44, 2011.
15. Willoughby RE, Tieves KS, Hoffman GM, Ghanayem NS, Amlie-Lefond CM, Schwabe 16. World Health Organization. WHO Expert Consultation on Rabies. First report. Geneva: MJ, et al. Survival after treatment of rabies with induction of coma. N Engl J Med. World Health Organization; 2005. 121p. (Technical Report Series; 931).
Received: 22 March 2010Accepted: 22 November 2010

Source: http://www.colegioveterinario.cl/adjuntosNoticias/raiva.pdf