MedicineLakex

 

P209-17 ijmcm vol 4, no 4 dr. omrani [ararvtscp] 94-10-05

IJMCM Original Article
Autumn 2015, Vol 4, No 4 Expression Pattern of Neuronal Markers in PB-MSCs Treated by
Growth Factors Noggin, bFGF and EGF
Zahra Fazeli1#, Sayyed Mohammad Hossein Ghaderian1,2#. Masoumeh Rajabibazl3, Siamak Salami3, Nader Vazifeh Shiran4, Mir Davood Omrani1,2∗ 1. Department of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 2. Urogenital Stem Cell Research Center, Shahid Beheshti University of Medical Sciences, Shahid Labbafi Nejad Educational Hospital, Tehran, Iran. 3. Department of Clinical Biochemistry, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 4. Department of Hematology, School of Allied Medical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 15 September 2015; Accepted 1 December 2015; Published 26 December 2015 Mesenchymal stem cells (MSCs) have the ability to differentiate into neuronal like cells under appropriate culture condition. In this study, we investigated whether MSCs derived from human peripheral blood (PB- MSCs) can differentiate into neuronal like cells by synergic effect of the growth factors EGF, bFGF and Noggin. For this purpose, the expression of five neuronal markers (Nestin, β III tubulin, NFM, MAP2 and NSE) were evaluated in treated PB-MSCs by SYBR Green Real time PCR. The expression analysis showed a higher expression of β- tubulin and NFM in treated BP-MSCs compared with untreated PB-MSCs as a control group. The expression of Nestin was also diminished in PB-MSCs treated with Noggin. This study suggested that the treatment of PB- MSCs with Noggin alongside with bFGF and EGF might differentiate these cells into neuronal lineage cells. The obtained results could be further developed for useful applications in regenerative medicine. Key words: Mesenchymal stem cells, differentiation, neuronal markers, Noggin
owadays, the regenerative medicine has fetal umbilical cord have the ability to differentiate Nprovided an alternative source of different into cell types of different organs (3-4). In other cell lines and organs through trans- differentiation alternative methods, the induced pluripotent stem process (1). During last decades, different strategies cells (iPSCs) generated from somatic cells have have been used to regenerate missing tissues (2). opened a new window in regenerative medicine (5). Some studies indicated that stem cells derived from However, the use of these cells was accompanied ∗Corresponding author: Department of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Email: [email protected] # These authors have equally contribution. by some limitations. For example, lentivirus vectors differentiation through blockage of Smad signalling including transcription factors for transformation of (20-21). Furthermore, it has been demonstrated that somatic cells into iPSCs could cause the recipient the inhibition of BMP signalling by Noggin along cells to exhibit long-term genetic aberrations (6). with activation of bFGF signalling could participate The characterization and isolation of stem cells into neural differentiation of MSCs (22). from different organs and tissues has represented an In this study, we attempted to differentiate alternative source of cells in cell therapy or peripheral blood derived MSCs (PB-MSCs) into regenerative medicine. However, it is not possible neuronal cells by inhibition of BMP signalling upon to isolate stem cells from some tissues including treatment with growth factors such as Noggin, central nervous system (CNS). Therefore, trans- bFGF and EGF. The expression of neural markers differentiation of stem cells derived from other like nestin, β III tubulin, neurofilament M (NFM), tissues could provide a suitable supply for microtubule- associated protein 2 (MAP2) and regeneration of these tissues. Current studies have neuron-specific enolase (NSE) in treated cells were demonstrated that the mesenchymal stem cells investigated to determine whether those growth (MSCs) derived from different tissues have the factors could influence the expression of these ability to differentiate into different cell types. multipotent cells that can Materials and methods
adipocytes, myocytes, endothelial cells, and PB-MSCs isolation
neurons (7-10). Although the primary sources of The peripheral blood (almost 6 ml) was MSCs are bone marrow, umbilical-cord blood, obtained from three healthy individuals. The blood olfactory bulb, amniotic fluid (AF), and Wharton's was collected in EDTA-treated tubes and layered jelly, these cells have also been found in peripheral over ficoll in a 2:1 ratio. The peripheral blood blood (11-12). Studies have demonstrated that mononuclear cells (PBMCs) were separated by MSCs have the ability to spontaneously express the density gradient centrifugation, plated in DMEM/F- neural markers including nestin, NeuN, gilal 12 medium containing 10% fetal bovine serum fibrillary acidic protein (GFAP) and βIII tubulin (FBS), 2 mM L- Glutamate and 100 units/ml (13). These observations could support the Penicillin/ Streptomycin (medium A) and then, predisposition of MSCs to differentiate toward incubated at 37 °C in a 5% CO2 humidified atmosphere. After 48 hours, media and unattached oligodendrocytes cells were removed by washing with phosphate- protocols have been published for differentiation of buffered saline (PBS). The adherent cells were MSCs into neuronal lineage cells (9, 14-16). There maintained in a fresh medium until approximately is increasing evidence about neural induction of 80% confluence was reached on day 6 of culture. MSCs by numerous growth factors (9, 17). These Flow cytometry analysis
growth factors are able to regulate neuronal The adherent cells were confirmed to be differentiation through different mechanisms (18). MSCs by flow cytometry. On day 6, the cells were It has been known that BMP2 is one of the most harvested with trypsin. After centrifuging at 450 g important bone morphogenetic proteins (BMPs) in for 5 min, the cells were suspended in DPBS and regulating the osteogenic differentiation (19). Previous studies indicated that the inhibition of (Fluorescein isothiocyanate) conjugated CD45 (BD BMP2 by Noggin prevented from osteogenic Biosciences, Cat# 347463, RRID: AB_400306) as Int J Mol Cell Med Autumn 2015; Vol 4 No 4 210 Treatment of PB-MSCs and Neuronal Gene Expression leukocyte marker, PE (Phycoerythrin) conjugated Total RNA was extracted from untreated and CD14 (BD Biosciences, Cat# 347497, RRID: growth factor-treated PBMSCs (day 14) using the total RNA purification kit (Jena Bioscience, conjugated CD44 (BD Biosciences, Cat# 347943, RRID: AB_400360), PE conjugated CD105 (BD instructions. DNase I treatment of RNA was Biosciences, Cat# 560839, RRID: AB_2033932) performed in a final volume of 50 µl containing 40 and PE conjugated CD73 (BD Biosciences, Cat # µl RNA, 5 µl RNase-free DNase I and 5 µl 10x 550257, RRID: AB_393561) for 30 min in the dark. reaction buffer (Fermentas, Thermo Scientific, The CD73, CD105 and CD44 served as surface Waltham, MA, USA). The mixture was incubated markers of MSCs. Negative control staining was for 30 min at 37 °C. Then, the enzyme was performed by using IgG1- FITC and IgG1-PE inactivated at 65 °C for 10 min. The complete isotype controls. Then, the cells were analyzed on removal of DNA was confirmed by electrophoresis Partec CyFlow Space cytometer using FloMax on 1% agarose gel. Finally, the cDNA template was software (http://flomax.software.informer. com/ 2.2 /). synthesized from extracted RNA using random Neuronal differentiation
hexamer primers and dART reverse transcriptase On day 6, the medium A was removed and the (EURx Ltd, Gdansk, Poland). cells were plated in medium A supplemented Real time quantitative PCR
with 0.1 mM NEAA, 2% B27 supplement, 1% The expression levels of neuronal marker N2 supplement, 50 ng/ml Noggin, 20 ng/ml EGF genes were evaluated by quantitative PCR (qPCR) and 10 ng/ml recombinant human bFGF (medium after 14 days of culture. The SYBR Green based B). The medium A was used as the control medium. qPCR was carried out on Rotor-Gene 6000 Real The growth factors Noggin, EGF and recombinant time PCR system. The qPCR reaction was prepared human bFGF were added to the medium every in a total volume of 25 µl containing 12.5 µl of 2X day. After three days culture in the medium B, SYBR Green master mix (Eurex, Poland), 5 µl of the EGF and recombinant human bFGF were the cDNA template, 0.2 µl of each primer (10 removed from the medium (medium C) and the pmol/µl) and 7.1 µl of deionized water. A negative cells were cultured for an additional six days control was used by replacing the cDNA template in medium C. The medium was changed every with deionized water. Primer sequences used in this study and their annealing temperature are shown in RNA extraction and cDNA synthesis
Table 1. Characteristics of qPCR primers pairs used in this study
Accession number Primer sequences
temperature (ºC) ence GGAAGTGCACCATGGAGAGGA (Reference gene) GCGAATCTTGTCCAAGGCATCAG CTCAGGGGCCTTTGGACATC CAGGCAGTCGCAGTTTTCAC ATCGCTCAGGTCCTGGAA AAGCTGAGGGAAGTCTTGGA CATGGGTCACAGGGCACCTATTC GGAGAACAGTGAAGCCTTGG GGTCAAATGGGTCCTCAATG 211 Int J Mol Cell Med Autumn 2015; Vol 4 No 4

The PCR amplification consisted of an initial Morphological changes of the growth factor-
denaturation at 95 ºC for 10 min, followed by 40 treated PBMSCs
cycles of denaturation at 95 ºC for 30 s, annealing The morphological features of untreated and at 60 ºC for 30 s and extension at 72 ºC for 30 s. growth factor-treated PBMSCs were observed The specificity of PCR products was verified by under inverted microscope. After being cultured for melting curves and electrophoresis through 3% 6 days, the PBMSCs adhered to the culture surfaces reached 70-80% confluence (Figure 1A). The The expression level of each gene was untreated PBMSCs showed mainly spindle- shaped calculated as fold change relative to the expression morphology. These cells had a tendency to become of reference gene (HSP90AB1) using pfaffl method flatter and wider over time. The neurosphere like (28). The statistical analysis was performed using cells were suspended 2-3 days after culture in the Social Science Statistics website (http: //www. medium induction containing growth factors socscistatistics.com /tests/studentttest/ Default2. Noggin, bFGF and EGF. Within 4-5 days after aspx). The ∆Ct value of treated versus untreated addition of growth factors, some cells began to look PBMSCs was compared by t-test. Data were like oligodendrocytes or astrocytes. After 8 days represented as fold change relative to the cell treatment with growth factors, the PBMSCs identifier using GraphPad Prism software (http: displayed multipolar shapes and bright cell bodies oligodendrocytes Fig. 1. Morphological features of PBMSCs treated with Noggin. A) Prior to treatment, PBMSCs showed fibroblast like shape on day 6. B)
PBMSCs after 4 days treatment with Noggin (Day 10). C) PBMSCs after 8 days treatment with Noggin (Day 14). The cells showed the multipolar processes. D) PBMSCs after 8 days treatment with Noggin (Day 14). The cells in this figure displayed synaptic structure. Int J Mol Cell Med Autumn 2015; Vol 4 No 4 212 Treatment of PB-MSCs and Neuronal Gene Expression Fig. 2. Flow cytometry analysis of adherent cells derived from peripheral blood. The cultured cells were CD45 and CD14 negative. In
contrast, presence of MSCs markers (CD73, CD105 and CD44) confirmed that the majority of these cells are MSCs. Fig. 3. Analysis of neuronal markers expression of the PBMSCs treated with growth factor Noggin. Graphs were generated using
GraphPad Prism 6. The results were obtained from three independent experiments.
213 Int J Mol Cell Med Autumn 2015; Vol 4 No 4 Expression pattern of surface markers on
used to establish neuronal stem cells (NSCs) and neuronal lineage cells. The safety problem is an The adherent cells derived from peripheral important issue to use of these cells as a therapeutic blood were analyzed by flow cytometry. As method (32). MSCs are an alternative source of expected, these cells were negative for leukocyte cells for use in treating patients with neurological marker CD45 as well as monocytic marker CD14. disease. It has been demonstrated that these cells The majority of these cells showed positive signal have the ability to differentiate into neuron like for mesenchymal cell makers CD105, CD44 and cells (9). Numerous reports have described different CD73 (Figure 2). protocols for differentiation of stem cells derived Expression levels of neural markers in growth
from peripheral blood. The previous studies factor treated-PBMSCs
revealed that PBMCs have ability to differentiate Quantitative analysis with qPCR revealed that into neural like cells in the presence of different the expression of NFM and βIII tubulin increased combinations of growth factors (33-34). In this significantly in the growth factor-treated group. study, a new combination of growth factors Almost three fold increase of βIII tubulin including Noggin, bFGF and EGF was used to expression was observed upon treatment in the two induce neural differentiation of MSCs derived from cultures of PBMSCs. The nestin expression level peripheral blood (PBMSCs) by inhibition of BMP was markedly reduced in the PBMSCs treated with signaling. To confirm the differentiation of Noggin. Treatment with Noggin, bFGF and EGF PBMSCs, the expression level of neural cell caused an increased expression of MAP2 and specific markers were assessed with qPCR. diminished expression of NSE in one of the treated- PB-MSCs showed changes in morphology and PBMSCs. In contrast, the other culture displayed a expression of neural markers upon treatment with reduction of MAP2 expression and augmentation of growth factors Noggin, bFGF and EGF. The cells in NSE expression after treatment with Noggin. The the present study had morphology different from third culture showed reduced expression of MAP2 the neural like cells described in the previous as well as NSE in growth factor-treated PBMSCs. studies. These observations suggested that these The graphs derived from these data are presented in cells belonged to different cell types of neural figure 3. The results obtained from statistical analysis indicated that there was no statistically Nestin is a marker of NSCs (35) that its significant difference between treated and untreated expression has also been observed in MSCs (36). It PBMSCs. This is probably due to the low number was revealed that the expression of nestin is inversely correlated with cellular differentiation (35). The expression of nestin decreased upon Discussion
treatment with growth factor Noggin, consistent Stem cell therapy is a new approach for the with differentiation of MSCs. Although the previous studies showed that the expression of neurological diseases (29). Different studies have nestin needs at least 10 passages of the cultured demonstrated that the embryonic stem cells can MSCs in serum free medium (37), but we observed give rise to neuronal cells (30-31). However, the nestin expression in MSCs following culture in ethical problems are major concerns in the use of medium supplemented with fetal bovine serum for these cells in cell therapy. In some studies, the 14 days. These results were consistent with the induced pluripotent stem cells (iPSCs) have been finding obtained by Foudah et al. (38). Int J Mol Cell Med Autumn 2015; Vol 4 No 4 214 Treatment of PB-MSCs and Neuronal Gene Expression β III tubulin and NFM are known to be the expression level was increased in one of treated cell early and late neuronal markers, respectively. These cultures with Noggin, consistent with their differentiation into neuron like cells. The previous undifferentiated MSCs (39). As observed in Figure studies indicated that the expression level of NSE 3, Noggin treatment of PBMSCs resulted in increased during the oligodendrocyte differentiation increased β III tubulin and NFM expression. The and NSE expression was repressed in mature results obtained from previous studies suggested oligodendrocytes (44). Furthermore, it has been that the in vitro culture could induce the found that low levels of NSE expression are present spontaneous expression of neural markers in MSCs. in astrocytes. Therefore, NSE expression data in our However, it has remained to be demonstrated (40). study suggested that treatment with Noggin was Different isoforms of MAP2 are expressed in accompanied by differentiation of PBMSCs into the neural lineage cells (41). The primer pair used different types of neurons, astrocytes and in the present study detects MAP2a, MAP2b and oligodendrocytes. MAP2c isoforms. These isoforms of MAP2 were In general, our results showed that PBMSCs could express some neural markers including differentiation. MAP2c is an early neuronal marker Nestin, βIII tubulin, NFM, MAP2 and NSE. and its expression decreased in the mature neurons. Accordingly, PBMSCs are a potential source of MAP2b was expressed in terminally differentiated cells that can be used to generate neuronal cells. neurons as well as during differentiation. MAP2a Although different induction protocols were expression was detectable in mature neurons (39). published about differentiation of MSCs into We observed a two-fold increase in the expression neuron like cells, the introduction of new protocols of MAP2 in one of treated PBMSCs as compared could improve our understanding from the with non-treated PBMSCs. This data along with characteristics of MSCs and the neuron like cells expression pattern of other markers suggested that derived from MSCs. Furthermore, the results PBMSCs differentiated into neuron like cells obtained from this study provide evidence of following treatment with Noggin. In contrast, qPCR neuronal differentiation of MSCs upon treatment analysis showed a decrease of MAP2 expression in with Noggin. However, neural marker expression the other two PBMSCs treated with noggin, analysis cannot be used as the only proof to proposing the differentiation of these treated cells demonstrate the neuronal differentiation of MSCs into oligodendrocytes. This fact was confirmed by following treatment with Noggin and the complete morphology assessment of treated PBMSCs. A understanding of these cells needs additional previous study on differentiating oligodendrocytes studies from the molecular, biological and has demonstrated that MAP2 expression transiently physiological aspects. increased in preoligodendrocytes. Its expression Conflict of interest
The authors declared no conflict of interests. differentiation of oligodendrocytes (42). Enolase is a key enzyme in the glycolytic References
pathway which plays an important role in energy production for cells. It has been revealed that γ- transdifferentiation shift the landscape of regenerative medicine. enolase (Eno2) was only found in cells of neuronal DNA and cell biology 2013;32:565-72. lineage (43). Our results showed that NSE 2. Jopling C, Boue S, Izpisua Belmonte JC. Dedifferentiation, 215 Int J Mol Cell Med Autumn 2015; Vol 4 No 4 transdifferentiation and reprogramming: three routes to of biomedicine & biotechnology 2012;2012:820821. regeneration. Nature reviews Molecular cell biology 2011;12:79- 14. Bae KS, Park JB, Kim HS, et al. Neuron-like differentiation of bone marrow-derived mesenchymal stem cells. Yonsei 3. Fu YS, Shih YT, Cheng YC, et al. Transformation of human medical journal 2011;52:401-12. umbilical mesenchymal cells into neurons in vitro. Journal of 15. Guan M, Xu Y, Wang W, et al. Differentiation into neurons biomedical science 2004;11:652-60. of rat bone marrow-derived mesenchymal stem cells. European 4. Fu YS, Cheng YC, Lin MY, et al. Conversion of human cytokine network 2014;25:58-63. umbilical cord mesenchymal stem cells in Wharton's jelly to 16. Hosseini SM, Talaei-Khozani T, Sani M, et al. dopaminergic neurons in vitro: potential therapeutic application Differentiation of human breast-milk stem cells to neural stem for Parkinsonism. Stem cells 2006;24:115-24. cells and neurons. Neurol Res Int 2014;2014:1-8. 5. Toyoda T, Mae S, Tanaka H, et al. Cell aggregation optimizes 17. Nandy SB, Mohanty S, Singh M, et al. Fibroblast Growth the differentiation of human ESCs and iPSCs into pancreatic Factor-2 alone as an efficient inducer for differentiation of bud-like progenitor cells. Stem cell research 2015;14:185-97. human bone marrow mesenchymal stem cells into dopaminergic 6. Gore A, Li Z, Fung HL, et al. Somatic coding mutations in neurons. Journal of biomedical science 2014;21:83. human induced pluripotent stem cells. Nature 2011;471:63-7. 18. Gaulden J, Reiter JF. Neur-ons and neur-offs: regulators of 7. Barry F, Boynton RE, Liu B, et al. Chondrogenic neural induction in vertebrate embryos and embryonic stem differentiation of mesenchymal stem cells from bone marrow: cells. Human molecular genetics 2008;17:R60-6. differentiation-dependent gene expression of matrix components. 19. Bais MV, Wigner N, Young M, et al. BMP2 is essential for Experimental cell research 2001;268:189-200. post natal osteogenesis but not for recruitment of osteogenic 8. Jaiswal RK, Jaiswal N, Bruder SP, et al. Adult human stem cells. Bone 2009;45:254-66. mesenchymal stem cell differentiation to the osteogenic or 20. Edgar CM, Chakravarthy V, Barnes G, et al. Autogenous adipogenic lineage is regulated by mitogen-activated protein regulation of a network of bone morphogenetic proteins (BMPs) kinase. The Journal of biological chemistry 2000;275:9645-52. mediates the osteogenic differentiation in murine marrow 9. Kim EY, Lee KB, Yu J, et al. Neuronal cell differentiation of stromal cells. Bone 2007;40:1389-98. mesenchymal stem cells originating from canine amniotic fluid. 21. Wang Y, Hong S, Li M, et al. Noggin resistance contributes Human cell 2014;27:51-8. to the potent osteogenic capability of BMP9 in mesenchymal 10. Oswald J, Boxberger S, Jorgensen B, et al. Mesenchymal stem cells. Journal of orthopaedic research : official publication stem cells can be differentiated into endothelial cells in vitro. of the Orthopaedic Research Society 2013;31:1796-803. Stem cells 2004;22:377-84. 22. Delaune E, Lemaire P, Kodjabachian L. Neural induction in 11. Chong PP, Selvaratnam L, Abbas AA, et al. Human Xenopus requires early FGF signalling in addition to BMP peripheral blood derived mesenchymal stem cells demonstrate inhibition. Development 2005;132:299-310. similar characteristics and chondrogenic differentiation potential 23. Jouhilahti EM, Peltonen S, Peltonen J. Class III beta-tubulin to bone marrow derived mesenchymal stem cells. Journal of is a component of the mitotic spindle in multiple cell types. The orthopaedic research : official publication of the Orthopaedic journal of histochemistry and cytochemistry : official journal of Research Society 2012;30:634-42. the Histochemistry Society 2008;56:1113-9. 12. Montesinos JJ, Flores-Figueroa E, Castillo-Medina S, et al. 24. Liu G, Yuan X, Zeng Z, et al. Analysis of gene expression Human mesenchymal stromal cells from adult and neonatal and chemoresistance of CD133+ cancer stem cells in glioblastoma. Molecular cancer 2006;5:67. immunophenotype, differentiation patterns and neural protein 25. Mareschi K, Novara M, Rustichelli D, et al. Neural expression. Cytotherapy 2009;11:163-76. differentiation of human mesenchymal stem cells: Evidence for 13. Foudah D, Redondo J, Caldara C, et al. Expression of neural expression of neural markers and eag K+ channel types. markers by undifferentiated rat mesenchymal stem cells. Journal Experimental hematology 2006;34:1563-72. Int J Mol Cell Med Autumn 2015; Vol 4 No 4 216 Treatment of PB-MSCs and Neuronal Gene Expression 26. Constantinescu R, Constantinescu AT, Reichmann H, et al. express a new class of intermediate filament protein. Cell Neuronal differentiation and long-term culture of the human neuroblastoma line SH-SY5Y. Journal of neural transmission 36. Wong A, Ghassemi E, Yellowley CE. Nestin expression in Supplementum 2007:17-28. mesenchymal stromal cells: regulation by hypoxia and 27. Hafizi M, Atashi A, Bakhshandeh B, et al. MicroRNAs as osteogenesis. BMC veterinary research 2014;10:173. markers for neurally committed CD133+/CD34+ stem cells 37. Wislet-Gendebien S, Hans G, Leprince P, et al. Plasticity of derived from human umbilical cord blood. Biochemical genetics cultured mesenchymal stem cells: switch from nestin-positive to excitable neuron-like phenotype. Stem cells 2005;23:392-402. 28. Pfaffl MW. A new mathematical model for relative 38. Foudah D, Redondo J, Caldara C, et al. Human mesenchymal quantification in real-time RT-PCR. Nucleic acids research stem cells express neuronal markers after osteogenic and adipogenic differentiation. Cellular & molecular biology letters 29. Lescaudron L, Naveilhan P, Neveu I. The use of stem cells in regenerative medicine for Parkinson's and Huntington's 39. Chung WJ, Kindler S, Seidenbecher C, et al. MAP2a, an Diseases. Current medicinal chemistry 2012;19:6018-35. alternatively spliced variant of microtubule-associated protein 2. 30. Morizane A, Takahashi J, Shinoyama M, et al. Generation of Journal of neurochemistry 1996;66:1273-81. graftable dopaminergic neuron progenitors from mouse ES cells 40. Croft AP, Przyborski SA. Formation of neurons by non- by a combination of coculture and neurosphere methods. Journal neural adult stem cells: potential mechanism implicates an of neuroscience research 2006;83:1015-27. artifact of growth in culture. Stem cells 2006;24:1841-51. 31. Park CH, Minn YK, Lee JY, et al. In vitro and in vivo 41. Shafit-Zagardo B, Kalcheva N. Making sense of the multiple analyses of human embryonic stem cell-derived dopamine MAP-2 transcripts and their role in the neuron. Molecular neurons. Journal of neurochemistry 2005;92:1265-76. neurobiology 1998;16:149-62. 32. Velasco I, Salazar P, Giorgetti A, et al. Concise review: 42. Vouyiouklis DA, Brophy PJ. Microtubule-associated Generation of neurons from somatic cells of healthy individuals proteins in developing oligodendrocytes: transient expression of and neurological patients through induced pluripotency or direct a MAP2c isoform in oligodendrocyte precursors. Journal of conversion. Stem cells 2014;32:2811-7. neuroscience research 1995;42:803-17. 33. Horschitz S, Meyer-Lindenberg A, Schloss P. Generation of 43. Marangos PJ, Parma AM, Goodwin FK. Functional neuronal cells from human peripheral blood mononuclear cells. properties of neuronal and glial isoenzymes of brain enolase. Neuroreport 2010;21:185-90. Journal of neurochemistry 1978;31:727-32. 34. Liu Q, Guan L, Huang B, et al. Adult peripheral blood 44. Sensenbrenner M, Lucas M, Deloulme JC. Expression of two mononuclear cells transdifferentiate in vitro and integrate into neuronal markers, growth-associated protein 43 and neuron- the retina in vivo. Cell biology international 2011;35:631-8. specific enolase, in rat glial cells. Journal of molecular medicine 35. Lendahl U, Zimmerman LB, McKay RD. CNS stem cells 217 Int J Mol Cell Med Autumn 2015; Vol 4 No 4

Source: http://www.ijmcmed.org/article-1-384-en.pdf